von Willebrand factor cleaving protease (ADAMTS-13) and ADAMTS-13 neutralizing autoantibodies in 100 patients with thrombotic thrombocytopenic purpura

The congenital or acquired deficiency of the von Willebrand factor (VWF) cleaving protease, ADAMTS-13 has been specifically associated with a diagnosis of thrombotic thrombocytopenic purpura (TTP), a microangiopathy characterized by the formation of occlusive platelet thrombi. The mechanisms of TTP were investigated in 100 patients diagnosed on the basis of the presence of at least three of the following: thrombocytopenia, haemolytic anaemia, elevated serum levels of lactate dehydrogenase and neurological symptoms. Plasma levels of ADAMTS-13 were severely reduced (46%) in 28%. A neutralizing antibody was the cause of the deficiency in 38% of the cases, with a higher prevalence of this mechanism (87%) in the 48 patients with severely reduced ADAMTS-13. Double heterozygosity for a 29 base pair (bp) deletion and a nucleotide insertion and homozygosity for a 6 bp deletion in the ADAMTS13 gene were identified only in two patients born from consanguineous marriages. In conclusion, this study indicated that ADAMTS-13 was normal in nearly one-third of patients with TTP and that ADAMTS-13 deficiency was not associated with the presence of neutralizing antibodies in more than half of the patients

Molecular and functional characterization of a natural homozygous Arg67His mutation in the prothrombin gene of a patient with a severe procoagulant defect contrasting with a mild hemorrhagic phenotype

In a patient who presented with a severe coagulation deficiency in plasma contrasting with a very mild hemorrhagic diathesis a homozygous Arg671His mutation was identified in the prothrombin gene. Wildtype (factor IIa [FIIa]-WT) and mutant Arg67His thrombin (FIIa-MT67) had similar amidolytic activity. By contrast, the k(cat)/K-m value of fibrinopeptide A hydrolysis by FIIa-WT and FIIa-MT67 was equal to 2.1 X 10(7) M(-1)s(-1) and 9 x 10(5) M(-1)s(-1). Decreased activation of protein C (PC) correlated with the 33-fold decreased binding affinity for thrombomodulin (TM; K-d = 65.3 nM vs 2.1 nM, in FIIa-MT67 and in FIIa-WT, respectively). In contrast, hydrolysis of PC in the absence of TM was normal. The Arg67His mutation had a dramatic effect on the cleavage of protease-activated G protein-coupled receptor 1 (PAR-1) 38-60 peptide (k(cat)/K-m = 4 x 107 M(-1)s(-1) to 1.2 x 10(6) M(-1)s(-1)). Flia-MT67 showed a weaker platelet activating capacity, attributed to a defective PAR-1 interaction, whereas the interaction with glycoprotein Ib was normal. A drastic decrease (up to 500-fold) of the second-order rate constant pertaining to heparin cofactor 11 (HCII) interaction, especially in the presence of dermatan sulfate, was found for the FIIa-MT67 compared with FIIa-WT, suggesting a severe impairment of thrombin inhibition by HCII in vivo. Finally, the Arg67His mutation was associated with a 5-fold decrease of prothrombin activation by the factor Xa-factor Va complex, perhaps through impairment of the prothrombin-factor Va interaction. These experiments show that the Arg67His substitution affects drastically both the procoagulant and the anticoagulant functions of thrombin as well as its inhibition by HCII. The mild hemorrhagic phenotype might be explained by abnormalities that ultimately counterbalance each othe

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion

BACKGROUND: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. DESIGN AND METHODS: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. RESULTS: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. CONCLUSIONS: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS1

Platelet ADAMTS13 and in vitro expression study of a patient affected by congenital TTP

Introduction : proteolysis of VWF is significantly reduced in congenital TTP patients due to ADAMTS13 deficiency. As 15-25% of circulating VWF is stored in platelets, the presence and function of platelet ADAMTS13 could play an important role in TTP pathogenesis. We studied a congenital TTP patient homozygous for a 6bp deletion in the exon 23 of ADAMTS13 gene. The effect of this mutation was verified either in plasma or in platelets and characterized by in vitro expression studies Methods : Furlan assay determined ADAMTS13 activity. The rADAMTS13 WT and mutant proteins were analyzed by Western Blot (WB), Furlan assay, immunofluorescence and pulse-chase labeling experiments. To analyze platelet ADAMTS13, the patient\u2019s washed platelets (1.2x109/ml) were lysed with 1% Triton X-100 and evaluated by WB and immunofluorescence studies using two monoclonal antibodies against CUB-1 and TSP1-1 repeat domains of ADAMTS13 Results : the patient\u2019s plasma showed no ADAMTS13 activity (<6%). WB and pulse-chase labeling experiments demonstrated a secretion pathway defect of the mutant protein, observed only in the conditioned media after 3 hours of chase. These data were also confirmed by immunofluorescence studies showing the presence of mutant protein diffused throughout the cytoplasm with only a minimal amount conserved at ER and Cis-Golgi. In WB both monoclonal antibodies detected a band of ~200 kDa either in the patient\u2019s platelet lysate or normal subject, confirming the presence of platelet ADAMTS13 in a similar amount between patient and normal subject, independently of the conserved plasmatic ADAMTS13. Immunofluorescence also confirmed these data by showing ADAMTS13 localization at the platelet membrane region with no apparent colocalization with \u3b1IIb\u3b2III. Conclusions : these data show that 6bp deletion leads to a secretion defect without changing the expression of platelet ADAMTS13, confirming that ADAMTS13 in platelets is not from plasma by endocytosis. The role of platelet ADAMTS13 needs to be further analyse

Determination of anti-ADAMTS13 autoantibodies in thrombotic thrombocytopenic purpura (TTP) patients : comparison of two different methods

Introduction : about 70 to 80% of TTP patients could develop autoantibodies that bind and/or inhibit ADAMTS13 by blocking its proteolytic activity or increasing its clearance in vivo, leading to a more or less severe deficiency of ADAMTS13. Therefore, determination of these autoantibodies could be very important for TTP diagnosis and for therapeutic strategies Methods : we selected 38 TTP patients with no ADAMTS13 inhibitor; the presence of anti-ADAMTS13 autoantibodies was determined by two methods: Western Blotting (WB) and ELISA. The proteolytic activity of ADAMTS13 and the presence of the ADAMTS13 inhibitor were determined by the method previously reported by Gerritsen (Thromb Haemost, 1999). The WB determination of anti-ADAMTS13 autoantibodies was performed by diluting the patients' plasma 1/100 and using conditioned media of cells stably transfected with ADAMTS13 wild type as a source of ADAMTS13 antigen. The ELISA method was performed as previously reported (Zhou, JBC 2005) with some modifications Results : of the 38 patients with no inhibitor, 42% (16/38) had ADAMTS13 activity <10%; 50% (19/38) had values ranging from 10 to 46%, and 8% (3/38) had normal values. The WB method determined the presence of anti-ADAMTS13 autoantibodies in 90% (34/38) of our patients, while only 61% (23/38) resulted positive according to the ELISA assay. All 16 patients with severe ADAMTS13 deficiency had anti-ADAMTS13 autoantibodies by WB, and only 11 out of 16 patients were positive by ELISA Conclusions : this study confirms that a negative result using the inhibitor assay does not exclude a diagnosis of autoimmune TTP, but this diagnosis also requires to use a second assay, either WB or ELISA. Our results found WB to be more sensitive method than ELIS